class: center, middle # Delving more deeply into UNIX ## Buffalo Chapter 3 ??? Notes for the _first_ slide! --- # Overview ##1) A Little Review ##2) Questions from Unix Tutorials ##3) New UNIX material: * Creating and navigating through directories * Using wildcards * Revisiting the Pipe and behold, `grep`! * Redirecting streams in pipes * Managing processes * Checking process exit status --- # A little review... * What are the kernel, the shell, and commands? -- * What is the difference between standard output and standard error? -- * How can standard output and standard error be redirected? -- ``` $ cat file1 file2 file3 > data 2> error ``` -- * How can standard output be appended to an existing file? -- ``` $ cat file4 file5 >> data ``` -- ##Pop Quiz: Will these two lines of code produce different results? ``` $ program < inputfile > outputfile $ cat inputfile | program > outputfile ``` --- class: center, middle # Questions about tutorials? --- class: center, middle # Name a few commands you've learned... --- class: center, middle # And now for something new... --- ## Creating and navigating through directories: -- * Let's set up a project as in Buffalo Chapter 3: -- ``` $ mkdir zmays-snps $ cd zmays-snps $ mkdir data $ mkdir data/seqs scripts analysis ``` -- * Try this in your course folder and use the `ls` and `cd` commands to make sure you understand what is happening with the last line of code -- * From within the `seqs` folder, how might you navigate to the `zmays-snps` folder in one line of code? --- ## The `rm` command and why nerds use underscores in their folder/file names: -- * Let's use our GUI to create a folder in `zmays-snps` with a space in its name: `raw sequences` -- * Now in `zmays-snps` let's create two more folders: ``` $ mkdir raw sequences ``` -- * Over the next few weeks we pile data into `raw` and `sequences` and then one night when we're under-caffeinated we decide to remove the `raw sequences` folder: ``` $ rm -rf raw sequences ``` -- * What just happened?
-- * How *should* we have removed the `raw sequences` folder? --- ## Using shell expansion to make your life easier: -- * Let's go ahead and delete the nice `zmays-snps` directory we've created: ``` $ rm -rf zmays-snps ``` -- * Note that this folder and *all its subdirectories* are erased...thank you `-rf` option -- * Now let's try creating the entire project directory in a single line of code: -- ``` $ mkdir -p zmays-snps/{data/seqs,scripts,analysis} ``` -- * Explain exactly what's going on here... -- * Note the use of the `-p` option for the `mkdir` command which allows for creation of intermediate directories as required -- * Let's use shell expansion to create some files in our reconstructed project directory: -- ``` $ cd zmays-snps/data $ touch seqs/zmays{A,B,C}_R{1,2}.fastq ``` --- ## Wildcards can make your life easier too! * Navigate into your `seqs` folder and use the `ls` command in combination with the `*` and `?` wildcards to match subsets of the files we just created -- * How do `*` and `?` match differently? -- * Let's create new `R1` and `R2` folders and use a wildcard range to move only the "A" and "B" files into these new folders: -- ``` $ mv zmays[AB]_R1* R1 $ mv zmays[AB]_R2* R2 ``` -- * Convince yourself only the appropriate files have been moved and then move the "C" files as well -- * Always be careful with wildcards, particularly when using the `rm` command. For example: -- How are these different? ``` $ rm -rf tmp-data/aligned-reads* $ rm -rf tmp-data/aligned-reads * ``` --- ##Revisiting the Pipe -- * In this example, how are standard out and standard error streams being funneled? ``` $ cat file1 file2 | grep "AGGATA" | wc ``` -- * Why pipe rather than create intermediate files? -- * Behold the mighty `grep` command!! -- * Let's see what this command can do using an example from Buffalo Chapter 3... -- Suppose we're working with a program that throws an error telling us that our fasta input file has non-nucleotide characters. Let's use grep in a pipe to inspect our input file: ``` $ grep -v "^>" tb1.fasta | grep --color -i "[^ATGC]" ``` --- ## Controlling streams within pipes -- * Pipes can string together multiple programs and increase the efficiency of our analysis -- * However, imagine your pipe includes 20 programs and multiple errors are thrown to your display during the analysis -- * Which program had the issue printed to standard error? -- * Let's talk through an example of how to manage this: -- ``` $ program1 input.txt 2> program1.stderr | \ program2 2> program2.stderr > results.txt ``` -- * But what if we want to send our standard output and standard error to the same place? -- ``` $ program1 2>&1 | grep "error" ``` --- ## But what if I really love intermediate files? -- * Sometimes you or your collaborator may need intermediate files in a pipeline for other analyses or for debugging -- * Can you retain the efficiency of the pipe while also creating intermediate files? -- * You betcha: -- ``` $ program1 input.txt | tee intermediate-file.txt | program2 > results.txt ``` --- ##Managing processes: sending programs to the background: -- * Often times our UNIX programs and pipelines will run for an extended amount of time -- * It is not terribly convenient to sit and stare at our terminal for weeks at a time -- * The running job also ties up our terminal if we're running it in the foreground (however, you can open up multiple tabs or terminals) -- * One solution to this is running your analysis in the background using the ampersand: -- ``` $ program1 input.txt > results.txt & ``` -- * This process will be run in the background, freeing up your terminal, and a process ID will be provided: -- ``` [1] 25744 ``` --- ##Managing processes: checking status and bringing to the foreground: -- * Say the next day we come to work and want to check quickly whether our analysis is still running: -- ``` $ jobs [1]+ Running program1 input.txt > results.txt ``` -- * And what if, now that we're back at work, we want to stare at the process while it runs all day? -- * This is where your process ID number will come in handy: -- ``` $ fg %25744 ``` -- * Now you can watch your process run to your heart's content -- * Question: *What happens when you run a program in the background and close your terminal application?* --- ##Managing processes: sending active programs to the background: -- * Say you start a program, realize it's going to take forever to run and then want to send it to the background... -- ``` $ program1 input.txt > results.txt $ # enter control-z here...NOT CONTROL-C!! [1]+ Stopped program1 input.txt > results.txt $ bg [1]+ program1 input.txt > results.txt ``` -- * To irrevocably kill a job type "control-c"; your job must be in the foreground for this to work --- ##Checking the exit status of a completed program * Say we come into work and find our program has completed with no errors printed to our display -- * To double-check that all has gone swimmingly, we can check the exit status by inspecting our shell variable: -- ``` $ grep -v "^>" tb1.fasta | grep --color -i "[^ATGC]" CCCCAAAGACGGACCAATCCAGCAGCTTCTACTGCTAYCCATGCTCCCCTCCCTTCGCCGCCGCCGACGC $ echo $? 0 ``` -- * You can utilize the exit status in your pipelines by implementing the shell operators `&&` and `||` -- * A few examples: -- ``` $ program1 input.txt > intermediate-results.txt && \ program2 intermediate-results.txt > results.txt ``` -- ``` $ program1 input.txt > intermediate-results.txt || \ echo "warning: an error occurred" ``` --- ##Exit status operators, `true` and `false` -- * There are two Unix commands that are very useful for understanding exit status, the shell variable and operators: `true` and `false` -- * `true` always sets the shell variable to 0 (success) -- * `false` always sets the shell variable to 1 (failure) -- * Try the following commands and see if what they return makes sense to you: ``` $ true && echo "first command was a success" $ true || echo "first command was not a success" $ false || echo "first command was not a success" $ false && echo "first command was a success" ``` --- ## Command substitution: -- * Sometimes rather than piping, we may actually want to nest commands within other commands -- * This process is called "command substitution" and here are a few examples... -- * `cd` into the `chapter-03-remedial-unix` folder of your Buffalo online materials and in your terminal type: ``` $ echo "There are $(grep -cv '^>' tb1.fasta) lines of sequence in my FASTA file." ``` -- * What is the result, and what's going on here? -- * Now `cd` into your `Week_3_play` folder and try: -- ``` $ mkdir results-$(date +%F) $ ls ``` -- * You can name folders and files with today's date without even knowing what that is!